Molecular > Plasmids > Index
| SysID | Name | Alternative name | Size | Source | Resistance | Description | Created at | Base vector | Usage | Sequence | |
|---|---|---|---|---|---|---|---|---|---|---|---|
09.0001 |
pDEST™14 | 6422 |
commercial from Invitrogen |
02/05/2009 |
|
|
|||||
09.0002 |
pBR322 | 4361 |
Fermentas |
Ampicillin; Tetracycline |
pBR322 E.coli cloning vector |
02/24/2009 |
|
|
|||
09.0004 |
pDRIVE | 3851 |
pDRIVE Cloning vector(QIAGen) |
02/25/2009 |
|
|
|||||
09.0005 |
pcDNA3 | 5400 |
Invitrogen |
Mammalian Selection - Neomycin Bacterial Resistance - Ampicillin |
high-level stable and trans |
03/10/2009 |
|
Mammalian expression |
GACGGATCGGGAGATCTCCCGATC |
||
09.0006 |
pBI221 | 5600 |
Hieter |
ori pUCAMPCDC53 |
for 35S::GUS |
03/16/2009 |
|
type - Plasmid |
|
||
09.0007 |
pSK / eL | 5545 |
informaxinc |
AMP+ |
with luciferase |
03/23/2009 |
|
|
|||
09.0008 |
pUC18 | 2686 |
Reznitsky |
URA Carb/Amp |
high copy number, E.coli pl |
06/04/2009 |
|
type - Plasmid. |
|
||
09.0009 |
pGEX-2TK | 4900 |
Clontech |
AMP+ |
HA-tagged human PAK1 (2.5 K |
07/29/2009 |
|
|
|||
09.0011 |
pBV220 | 3666 |
Yushi |
ori pUC AMP SIC1 |
CUL2 cDNA fragment BamHI-No |
08/24/2009 |
|
cloning |
|
||
09.0013 |
pKT007 | 6700 |
kevin travers |
yeast markers - URA3. bacterial markers - Amp. |
UPRE-GFP plasmid.Has 4xUPR |
11/01/2009 |
pRS306 |
|
|||
09.0014 |
p425 | 6000 |
Yamamoto lab |
yeast markers - LEU2. bacterial markers - Amp. |
YGL020C + 500 bp upstream a |
11/01/2009 |
pRS316 |
|
|||
09.0015 |
pRS316 | 1 |
|
11/01/2009 |
|
|
|||||
09.0016 |
p427 | 6530 |
Aruna |
yeast markers - URA3. bacterial markers - Amp. |
2µ high copy plasmid for ov |
11/01/2009 |
pBR |
tagttattaatagtaatcaattacggg |
|||
09.0017 |
pKan-Gal | 4730 |
Vlad |
yeast markers - Kan. bacterial markers - Amp. |
plasmid for changing a prom |
11/01/2009 |
pUC18 |
|
|||
11.0052 |
pBR-GUF | 7800 |
|
11/01/2009 |
pBR |
|
|||||
09.0019 |
pRS306 | 9000 |
|
11/01/2009 |
|
|
|||||
09.0020 |
pCgTrp1 | 4500 |
Vlad |
yeast markers - Trp. bacterial markers - Amp. |
KO plasmid containing TRP1 |
11/01/2009 |
pUC18 |
gatcctccatatacaacggtatctc |
|||
09.0021 |
pBR | 7800 |
|
11/01/2009 |
|
|
|||||
10.0027 |
pYG54 | 54000 |
|
07/15/2010 |
|
|
|||||
10.0035 |
pCMV-GLuc | 5674 |
NEB |
contains the "humanized" constitutive expression in mammalian cells |
07/27/2010 |
|
constitutive expression in mammalian cells |
|